Authors
- Khadije Rezaei keykhaei 1
- Nesa Rajabpour Nikoo 2
- Hamid Vaez 3
- Leili Rezaei keikhaei 4
- Mahboobeh Shirazi 5
- Marjan Ghaemi 5
- Soleiman Saravani 4
- Sanaollah Raeiszadeh 4
- Asadollah Rezaei 4
1 Zabol Medicinal Plants Research Center, Zabol University of Medical Sciences, Zabol, Iran 2. MD, Shohada Hospital, Qom, Iran
2 Department of Microbiology, School of Medicine, Zabol University of Medical Sciences, Zabol, Iran
3 Department of Microbiology, School Of Medicine, Zabol University Of Medical Sciences, Zabol, Iran
4 Zabol Medicinal Plants Research Center, Zabol University Of Medical Sciences, Zabol, Iran
5 Maternal, Fetal &Neonatal Research Centre, Tehran University of medical sciences, Tehran, Iran
Abstract
Background & Objective: Mycoplasma hominis, which belongs to the Mycoplasmataceae family, is an opportunistic pathogen of the genitourinary system. Mycoplasma genitalium, causing urethritis-endometritis-cervicitis, plays a role in prostatitis This study aimed to investigate the prevalence of M. genitalium and M. hominis among women with vaginal infection in Zabol, Iran.
Materials & Methods: In this cross-sectional study, 69 endocervical samples were taken from women aged 18 to 60 years who suffered from vaginal infections. DNAs extracted from the samples were applied as a template for 16SrDNA coding gene amplification using specific primers in two separate PCR reactions.
Results: The highest infection rate was in the age group of 25 to 35 years, with a prevalence of 75%. The highest rate of negative PCR results (54%) was in the age group of 25 to 35 years, followed by the age groups of 36 to 45 years (28%), 18 to 24 years (4%), and older than 45 years (3%). The lowest rate was in the age group younger than 18 years (2%). Considering their levels of education, the highest rate of infection was seen in the subjects with bachelor’s degrees. The rate of Mycoplasma genitalium infection was equal in the subjects who had and did not have a miscarriage (50%). Only 5.7% of the subjects with negative PCR samples had a miscarriage and the rest (94.3%) did not experience a miscarriage.
Conclusion: Overall, the present study showed that the rate of Mycoplasma vaginal infections was very low Also there is no significance deference for infection rate between pregnant women with or without miscarriage history. However, those with Mycoplasma-negative PCR samples had a low miscarriage rate.
Keywords
Mycoplasma hominis, which belongs to the Mycoplasmataceae family, is an opportunistic pathogen of the genitourinary system. The presence of these bacteria as a member of microbial flora in healthy people and their role in the pathogenesis of the genitourinary system have always been controversial. Among the major causes of the pathogenicity of these bacteria, the change in vaginal conditions and their replacement with normal flora, including Lactobacillus, can be mentioned. Rapid diagnosis of genital mycoplasmas in patients with genital infections, due to their role in miscarriage, postpartum fever, preterm labor, and chorioamnionitis, is very important (1). Mycoplasmas are the smallest single-celled organisms that are pathogenically isolated from plants, animals, and humans. Some of these bacteria are normal flora of the respiratory and genital systems (2). M. hominis also plays a role in prostatitis, postpartum fever, recurrent spontaneous miscarriage, pyelonephritis, stillbirth, low birth weight, neonatal pneumonia, and neonatal meningitis (3). Mycoplasma genitalium, in addition to causing urethritis-endometritis-cervicitis, plays a role in prostatitis (4). Among the mycoplasmas isolated from humans, the role of M. hominis, as an opportunistic organism causing infection in the genital tract, was proved. Genital mycoplasmas, especially M. hominis and M. genitalium, reside naturally in the genitourinary systems of men and women who have sexual intercourses (5). Using the conventional Polymerase chain reaction (PCR), the isolation rate of M. genitalium ranged from 0-6% in the United Kingdom and was 34.4% in New Zealand (6). M. hominis is the first bacterium of human origin isolated in 1973. This bacterium is found in the vagina of 2.3% of women with bacterial vaginosis and 10% of healthy women. In pregnant women with bacterial vaginosis, the risk of premature rupture of the fetal membranes, preterm labor, and postpartum endometritis (after cesarean section) is increased. M. hominis also plays a role in prostatitis, postpartum fever, recurrent spontaneous miscarriage, pyelonephritis, stillbirth, low birth weight, neonatal pneumonia, and neonatal meningitis (3). Mycoplasmas are hard to grow and require special conditions to proliferate in culture. Bacterial culture is a standard method for the detection of mycoplasmas; however, this method is very difficult and requires specific culture media (7).
Studies have shown that PCR is a more efficient molecular diagnostic method compared to culture in the detection of these bacteria (8). Nowadays, this technique is widely used to identify pathogenic microbes in patient samples. Using this technique, the pathogenic factors are detectable in more patients. Proving a pathogen is essential for considering the optimal treatment that patients require. Culture methods lack sufficient sensitivity and specificity, which may be due to prior treatment with antibiotics and/or pathogens that are inherently difficult to cultivate. Among these pathogens, species of Bordetella, Legionella, Coxiella, and Mycoplasma can be noted. This study aimed to investigate the use of PCR technique for differential diagnosis of Mycoplasma hominis and Mycoplasma genitalium in samples taken from women with vaginal infection referred to Imam Khomeini Hospital and Amir al-Momenan Hospital in Zabol, Iran. Given the potential impact of mycoplasmas on the complications of maternal infection and mortality, timely diagnosis and treatment are needed more than ever.
In this descriptive cross-sectional study, under the supervision of a gynecologist, 69 endocervical samples were taken from women aged 18 to 60 years old who suffered from vaginal infections and referred to Imam Khomeini Hospital and Amir-al-Momen Hospital in Zabol, Iran, in 2017. The inclusion criteria of this study were having one or more symptoms of genital infection, such as burning and itching in the genital tract and increased discharge and discoloration, and not taking antibiotics and vaginal cream two days before the referral. A questionnaire was designed to collect the subjects’ data, including their age, marital status, history of urinary tract infection, miscarriage, history of Pap smear, and use of vaginal cream, antibiotics, and oral contraceptives, as well as the data related to the diagnosis made by their physicians and the subjects’ clinical symptoms. Sampling was performed by obtaining the subjects’ full consent and without imposing any additional costs on the subjects. The samples were collected by two sterile swabs and speculums from the endocervical and vaginal regions, placed in 500 µL PBS, and transferred to the laboratory for carrying out the diagnostic test in the shortest time possible.
Chromosomal DNAs were extracted from all the samples of transient buffers prepared using the Gram-negative DNA Extraction Kit and applied as a template for 16 SrDNA coding gene amplification using specific primers. For amplification, the PCR technique was used (Table 1). The PCR reaction was performed in a final volume of 25 µL in 35 cycles at an initial temperature of -95°C and at temperatures of 62°C, for primer binding in M. genitalium, 59.5°C, for M. hominis, and 72°C, for continuing the reaction, each one lasted for a minute. At the end of the study, the data obtained from the laboratory studies were described via SPSS 16 (version 16; SPSS Inc., Chicago, IL US), using statistical methods, i.e., mean, frequency, standard deviation, tables, and figures.
Table 1. The primer sequences used
| Used to identify Mycoplasma genus |
| My-ins(5'-GTAATACATAGGTCGCAAGCGTTATC-3'),520bp MGSO-2-Bi (5'-CACCATCTGTCACTCTGTTAACCTC-3') |
| Used to identify Mycoplasma hominis |
| RNAH1 5' (CAATGGCTAATGCTGGATACGC)344bp RNAH2 5' GGTACCGTCAGTCTGCAAT |
| Used to identify Mycoplasma genitalium |
| MGF: 5/-TACATGCAAGTCGATCGGAAGTAGC-3/427bp MGR: 5/-AAACTCCAGCCATTGCCTGCTAG-3 |
Out of the 69 available samples examined, 11 samples (14.5%) were unacceptable due to poor storage and transportation conditions. Out of the other 58 samples, the Mycoplasma genus-PCR results were positive for 5 samples (Figure 1). Among these five positive PCR results, the Mycoplasma genitalium-PCR results were positive for 4 samples (Figure 2). No samples were positive for Mycoplasma hominis.
Figure 1. The Mycoplasma genus-PCR results
Figure 2. The Mycoplasma genitalium-PCR result
In the present study, the subjects’ age ranged from 18 to 60 years old, with a mean age of 33 years. The highest rate of infection (75%) was in the age group of 25 to 35 years. The highest rate of negative PCR results (54%) was in the age group of 25 to 35 years, followed by the age groups of 36 to 45 years (28%), 18 to 24 years (4%), and older than 45 years (3%). The lowest rate (2%) was for the age group of younger than 18 years old. These differences were statistically significant (P=0.000).
In this study 91.4% of the subjects were married and 8.6% of them were single. All cases of Mycoplasma positive were among the married subjects. These differences were not statistically significant (P=0.773).
The rate of M. genitalium infection was 8.3% in the rural population and 6.5% in the urban population. The rate of mycoplasma genus was 91.7% in the rural population and 91.3% in the urban population. These differences were not statistically significant (P=0.858).
Considering their levels of education, the highest rate of infection was seen in the subjects with bachelor’s degrees (50% of M. genitalium cases), followed by those with associate degrees (25% of M. genitalium cases) and diplomas (25% of M. genitalium cases). These differences were not statistically significant (P=0.739). The highest rate of Mycoplasma infection was seen in the subjects who belonged to a moderate economic level (50%), followed by those who had a good economic level (25%) and a poor economic level (25%). These differences were not statistically significant (P=0.708).
The rate of M. genitalia infection in those who had a miscarriage was equal to those who did not have a miscarriage (50%). However, 94.3% of those with negative PCR samples had no miscarriages and only 5.7% of these subjects had a miscarriage. These differences were statistically significant (P=0.009).
In terms of the subjects’ gravidity, the subjects with 4 gravidae (50%), followed by those who had 3 and 2 gravidae (25%), had the highest M. genitalia infection. Of those who had negative PCR results, the highest gravidity was 3 (28.3%) followed by 5, 2, 4, 1, and 7 (20.8%, 15.1%, 11.3%, 9.4%, 5.7%, and 5.7%, respectively) and the lowest gravidity was 6 (3.8%). These differences were not statistically significant (P=0.857).
Discussion
Genital infections can cause mortality and morbidity (9-11). Mycoplasma bacteria, as a microbial flora in healthy people, are opportunistic pathogenic agents of the genitourinary system. Changes in vaginal conditions and the replacement of various pathogens, including Lactobacillus instead of normal flora, are major pathogens of mycoplasmas. Due to complications such as miscarriage, postpartum fever, preterm labor, and chorioamnionitis, rapid diagnosis and treatment of genital mycoplasmas are important (1,12).
In the present study, 16% of the samples were unacceptable. This may be because mycoplasmas lack cell walls; hence, they are sensitive to environmental conditions and may become weak or die during sampling or transferring to the laboratory. In the current study, the PCR results showed that 8.6% of the samples had Mycoplasma genus and 6.8% of them had Mycoplasma genitalium. Several studies conducted in different countries all around the world have demonstrated that the frequency of M. genitalium was 4.5% in Norway, 4.8% in New Zealand, 5% in Sudan, 7% in the USA, 7.6% in Venezuela, 17.2% in Kenya, and 38.2 % in France (13-19).
The most positive cases were seen in 29-39 years old; these results were similar to studies conducted in India and Turkey, which is due to the closeness of the culture of these countries with Iran (20). Some studies showed that these bacteria are directly related to the economic and social status of women, financial poverty, relationships with multiple sexual partners, the use of birth control pills, and the age of sexually active women (21) although in our study we did not see this conclusion.
In our study, women in the second to fourth pregnancies were prone to mycoplasma infection. Elemental studies have shown that people with more than 2 pregnancies have a higher incidence of mycoplasma infection.
Studies have shown that the prevalence of these bacteria in the female reproductive system is directly correlated with socioeconomic status, poverty, sex with multiple partners, contraceptive use, and the age of sexually active women (22). However, in this study, the rate of vaginal infection was not associated with economic status, level of education, place of residence, and marital status.
Conclusion
Overall, the present study showed that the rate of Mycoplasma vaginal infections is very low. Furthermore, this study indicated that the samples’ marital status, place of residence, level of education, economic status, and gravidity were not correlated with Mycoplasma vaginal infections. The rates of Mycoplasma genitalium infection in the samples who had and did not have a miscarriage were equal. However, those with Mycoplasma-negative PCR samples had a low miscarriage rate.
Acknowledgments
We would like to express our sincere gratitude to the Vice Chancellor for Research and Technology of Zabol University of Medical Sciences, who sponsored the present research project. Also, the staff of Imam Khomeini and Imam Ali (AS) hospitals located in Zabol city who helped us in collecting samples are appreciated.
Conflicts of Interest
Authors declared no conflict of interests.
- Donders GG, Van Bulck B, Caudron J, Londers L, Vereecken A, Spitz B. Relationship of bacterial vaginosis and mycoplasmas to the risk of spontaneous abortion. Am J Obstet Gynecol 2000 Aug 1;183(2):431-7.. [DOI:10.1067/mob.2000.105738] [PMID]
- Kayser FH BK, Eckert J, Zinkernagal RM. pathogens in general mycology: Thieme; 2005.
- Westberg J, Persson A, Holmberg A, Goesmann A, Lundeberg J, Johansson KE, Pettersson B, Uhlén M. The genome sequence of Mycoplasma mycoides subsp. mycoides SC type strain PG1T, the causative agent of contagious bovine pleuropneumonia (CBPP). Genome Res. 2004 Feb 1;14(2):221-7.4. [DOI:10.1101/gr.1673304] [PMID]
- Xia SJ, Cui D, Jiang Q. An overview of prostate diseases and their characteristics specific to Asian men. Asian J Androl. 2012 May;14(3):458. 5. Rosemond A, Lanotte P, Watt S, Sauget AS, Guerif F, Royere D, Goudeau A, Mereghetti L. Systematic screening tests for Chlamydia trachomatis, Mycoplasma hominis and Ureaplasma urealyticum in urogenital specimens of infertile couples. Pathol Biol. 2006 Apr;54(3):125-9. [DOI:10.1016/j.patbio.2005.09.004] [PMID]
- Lawton BA, Rose SB, Bromhead C, Gaitanos LA, MacDonald EJ, Lund KA. High prevalence of Mycoplasma genitalium in women presenting for termination of pregnancy. Contraception. 2008 Apr 1;77(4):294-8.7. [DOI:10.1016/j.contraception.2007.12.002] [PMID]
- Stellrecht KA, Woron AM, Mishrik NG, Venezia RA. Comparison of multiplex PCR assay with culture for detection of genital mycoplasmas. J Clin Microbiol. 2004 Apr 1;42(4):1528-33.8. [DOI:10.1128/JCM.42.4.1528-1533.2004] [PMID]
- Teng K, Li M, Yu W, Li H, Shen D, Liu D. Comparison of PCR with culture for detection of Ureaplasma urealyticum in clinical samples from patients with urogenital infections. J Clin Microbiol 1994; 32: 2232-4. [DOI:10.1128/JCM.32.9.2232-2234.1994] [PMID]
- Sarani M Sz, Shirazi M, Saravani S. Risk Factors of Maternal Mortality in Sistan Region: 10-Year Report. Tehran University Medical Journal 2014;72:623-9.
- Shirazi M, Abbariki E, Hafizi A, Shahbazi F, Bandari M, Dastgerdy E. The prevalence of group B streptococcus colonization in Iranian pregnant women and its subsequent outcome. Int J Fertil Steril 2014; 7: 267-70.
- Shirazi M, Shahbazi F, Pirzadeh L, Mohammadi SR, Ghaffari P, Eftekhar T. Tuberculosis endometritis presenting as a leiomyoma. Int J Fertil Steril 2015; 8: 481-4.
- Mohseni R SF, Miri Nm, Eghbali M, Dezhkame S, Ghane M. A study on the frequency of vaginal species of Mycoplasma genitalium, Gardnerella vaginalis and Neisseria gonorrhoeae among pregnant women by PCR technique. International Journal of Molecular and Clinical Microbiology 2013; 3: 231-6.
- Arraiz RN, Colina Ch S, Marcucci JR, et al. Mycoplasma genitalium detection and correlation with clinical manifestations in population of the Zulia State, Venezuela. Rev Chilena Infectol 2008; 25: 256-61. [DOI:10.4067/S0716-10182008000400002] [PMID]
- Casin I, Vexiau-Robert D, De La Salmoniere P, Eche A, Grandry B, Janier M. High prevalence of Mycoplasma genitalium in the lower genitourinary tract of women attending a sexually transmitted disease clinic in Paris, France. Sex Transm Dis 2002; 29: 353-9. [DOI:10.1097/00007435-200206000-00008] [PMID]
- Johannisson G, Enstrom Y, Lowhagen GB, et al. Occurrence and treatment of Mycoplasma genitalium in patients visiting STD clinics in Sweden. Int J STD AIDS 2000; 11: 324-6. [DOI:10.1177/095646240001100508] [PMID]
- Manhart LE, Mostad SB, Baeten JM, Astete SG, Mandaliya K, Totten PA. High Mycoplasma genitalium organism burden is associated with shedding of HIV-1 DNA from the cervix. J Infect Dis 2008; 197: 733-6. [DOI:10.1086/526501] [PMID]
- Moi H, Reinton N, Moghaddam A. Mycoplasma genitalium is associated with symptomatic and asymptomatic non-gonococcal urethritis in men. Sex Transm Infect 2009; 85: 15-8. [DOI:10.1136/sti.2008.032730] [PMID]
- Oliphant J, Azariah S. Cervicitis: limited clinical utility for the detection of Mycoplasma genitalium in a cross-sectional study of women attending a New Zealand sexual health clinic. Sex Health 2013; 10: 263-7. [DOI:10.1071/SH12168] [PMID]
- Sarani M, Shahraki Z, Shirazi M, Saravani S. Risk factors of maternal mortality in Sistan region: 10-year report. Tehran University Medical Journal. 2014;72
- Amirmozafari N, Jeddi F, Masjedian F, Haghighi L. Prevalence of Mycoplasma hominis and Ureaplasma urealyticum in Genitourinary Tract Infections. J Iran Med Sci. 2008;60(15):19-23.
- Blanchard A, Hentschel J, Duffy L, Baldus K, Cassell G. Detection of Ureaplasma urealyticum by polymerase chain reaction in the urogenital tract of adults, in amniotic fluid, and in the respiratory tract of newborns. Clinical Infectious Diseases. 1993;17(Supplement_1):S148-S53 [DOI:10.1093/clinids/17.Supplement_1.S148] [PMID]
- Onsory K, Shahbani-Zahir H, Haji Mehdi Nouri Z, Abdolahi M. Frequency of Mycoplasma genitalium and Mycoplasma hominis among the women with vaginal infection in Robat Karim-Tehran (2013). Feyz Journal of Kashan University of Medical Sciences. 2016;20(3):244-51
- Blanchard A, Hentschel J, Duffy L, Baldus K, Cassell GH. Detection of Ureaplasma urealyticum by polymerase chain reaction in the urogenital tract of adults, in amniotic fluid, and in the respiratory tract of newborns. Clin Infect Dis 1993;17 Suppl 1: S148-53. [DOI:10.1093/clinids/17.Supplement_1.S148] [PMID]
)
